Comparative Analysis of the Expression of Involucrin, Filaggrin and Cytokeratin 4, 10, 16 in Cholesteatoma

نویسندگان

  • Hyun Jung Min
  • Chul Won Park
  • Jin Hyeok Jeong
  • Seok Hyun Cho
  • Kyung Rae Kim
  • Seung Hwan Lee
چکیده

BACKGROUND AND OBJECTIVES The aim of this study is to determine whether the hyperproliferative and hyperkeratotic characters of cholesteatoma are associated with differentiation of keratinocytes in cholesteatoma by examining the localization of marker proteins, such as involucrin, filaggrin, and cytokeratins. MATERIALS AND METHODS Immunohistochemical study was carried out in 30 cholesteatoma tissues and 10 retroauricular skins to examine the expression of involucrin, filaggrin, cytokeratin 4, 10 and 16. The staining results were graded as negative, weakly positive (<10%), moderately positive (10-70%), and strongly positive (>70%). RESULTS Involucrin was strongly expressed in upper spinous, granular, and corneal layer of cholesteatoma. Filaggrin was strongly expressed in granular and corneal layer of cholesteatoma. Cytokeratin 4 was expressed in basal layer of retroauricular skin, but occasionally expressed in suprabasal layer of cholesteatoma. Cytokeratin 10 was homogenously expressed in all suprabasal layer of retroauricular skin, whereas pattern of shift to surface layer was showed in cholesteatoma. Cytokeratin 16 was moderately expressed at suprabasal layer in cholesteatoma. CONCLUSIONS It can be suggested that early differentiation of suprabasal layer may lead to hyperdifferentiation and hyperkeratosis. Different expression of cytokeratins possibly indicates the altered differentiation of cholesteatoma.

برای دانلود رایگان متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

Is Ki-67, keratin 16, involucrin, and filaggrin immunostaining sufficient to diagnose inflammatory linear verrucous epidermal nevus? A report of eight cases and a comparison with psoriasis vulgaris*

Inflammatory linear verrucous epidermal nevus and linear psoriasis are sometimes hard to differentiate clinically and pathologically. Although immunohistochemical expression of keratin 10 (K10), K16, Ki-67, and involucrin may be useful for differentiating both entities, these results have been reported in only a few cases. We collected data from 8 patients with inflammatory linear verrucous epi...

متن کامل

Changes in the expression of epidermal differentiation markers at sites where cultured epithelial autografts were transplanted onto wounds from burn scar excision.

This study investigated the recovery process during which grafted cultured epithelium formed normal epidermis. The subjects were 18 patients whose burn scars were excised at a depth not exposing the fat layer and who subsequently received cultured epithelial autografts. A total of 24 samples were obtained from the grafted sites: 6 samples within 6 weeks (stage 1), 5 samples after 6 weeks and wi...

متن کامل

Recruitment of cycling epidermal cells and expression of filaggrin, involucrin and tenascin in the margin of the active psoriatic plaque, in the uninvolved skin of psoriatic patients and in the normal healthy skin.

The peripheral changes in the uninvolved skin adjacent to the extending psoriatic lesions may represent early events. The sequence of these events remains controversial. In the present study we evaluated epidermal and dermal aspects of the margin of the progressive psoriatic plaque, the distant uninvolved skin and normal healthy skin, using immunohistochemistry with markers for keratinization, ...

متن کامل

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR...

متن کامل

Elevated expression of transglutaminase 1 and keratinization-related proteins in conjunctiva in severe ocular surface disease.

PURPOSE In severe ocular surface diseases, pathologic keratinization of the ordinarily nonkeratinized corneal and conjunctival mucosal epithelia results in severe visual loss. The expression in conjunctivalized corneas of various proteins known to play important roles in the physiological keratinization process in human epidermis was examined to better understand the mechanism of keratinization...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

عنوان ژورنال:

دوره 16  شماره 

صفحات  -

تاریخ انتشار 2012